"My administration is committed to promoting scientific integrity and pioneering scientific research and I am confident that Dr. Francis Collins will lead the NIH to achieve these goals"
From
Falsified Data Found in Gene Studies NYTimes, Oct 30, 1996
Dr. Collins rejected the idea that closer supervision would have prevented the problem because the trainee ''got quite a bit of attention from me'' and with others in the laboratory.
He also said he was ''grateful for the care that reviewer took looking at a figure that I must have looked at 50 times and that other people in the laboratory had looked at at least as often, in seeing what had eluded all of us.''
From
Cleaning up he paper trail SCIENCE VOL 312 7 APRIL 2006
Dr. Collins, "The responsibility is very much on the shoulders of those who know [of fraud]
to correct the record as speedily as possible.”
FROM
F] Federal Register / Vol. 62, No. 135 / Tuesday, July 15, 1997 / Notices
DEPARTMENT OF HEALTH AND HUMAN SERVICES
Office of the Secretary
Findings of Scientific Misconduct
AGENCY: Office of the Secretary, HHS.
ACTION: Notice.
-----------------------------------------------------------------------
SUMMARY: Notice is hereby given that the Office of Research Integrity
(ORI) has made a final finding of scientific misconduct in the following case:
Amitav Hajra, University of Michigan: Based upon a report from the University of Michigan, information obtained by the Office of Research
Integrity (ORI) during its oversight review, and Mr.Hajra's own admission, ORI found that Mr. Hajra, former graduate student, University of Michigan, engaged in scientific misconduct by falsifying and fabricating research data in five published research papers, two published review articles, one submitted but unpublished paper, in his doctoral dissertation,and in a submission to the GenBank computer data base. Mr. Hajra's doctoral training and research was supported by two Public Health Service (PHS) grants, and his experiments were conducted at and submitted for publication from the National Center for Human Genome Research, National Institutes of Health (NIH).
Specifically, Mr. Hajra fabricated and falsified original research in the following publications:
Hajra, A., Collins, F.S. ``Structure of the leukemia-associated human CBFB gene.'' Genomics 26(3):571-579,1995 (Retracted in Genomics 38(1):107, 1996);
Hajra, A., Liu, P.P., Speck, N.A., Collins, F.S.
``Overexpression of core-binding factor (CBF)
reverses cellular transformation by the CBF-smooth muscle myosin heavy chain chimeric oncoprotein.'' Molecular and Cellular
Biology 15(9):4980-4989, 1995;
Hajra, A., Liu, P.P., Wang, Q., Kelley, C.A., Stacy, T., Adelstein, R.S., Speck, N.A., and Collins, F.S. ``The leukemic core binding factor -smooth muscle myosin heavy chain(CBF-SMMHC) chimeric protein requires both CBF and myosin heavy chain domains for transformation of NIH 3T3 cells.'' Proc. Natl. Acad. Sci. USA 92(6):1926-1930, 1995;
Wijmenga, C., Gregory, P.E., Hajra, A., Schrock, E., Ried, T., Eils, R., Liu, P.P., and Collins, F.S. ``Core binding factor -smooth muscle myosin heavy chain chimeric protein involved in acute myeloid leukemia forms unusual nuclear rod-like structures in
transformed NIH 3T3 cells.'' Proc. Natl. Acad. Sci. USA 93(4):1630-1635, 1996; and
Liu, P.P., Wijmenga, C., Hajra, A., Blake, T.B., Kelley, C.A., Adelstein, R.S., Bagg, A., Rector, J., Cotelingham, J., Willman, C.L., and Collins, F.S.
“Identification of the chimeric protein
product of the CBFB-MYH11 fusion gene in inv(16)leukemia cells.'' Genes, Chromosomes, and Cancer 16:77-87, 1996 (Erratum in Genes,
Chromosomes, and Cancer 18(1):71, 1997).
Mr. Hajra included fabricated and falsified data in the following
review articles: Hajra, A., Liu, P.P., and Collins, F.S. ``Transforming
properties of the leukemic Inv(16) fusion gene CBFB MYH11.'' In Molecular Aspects of Myeloid Stem Cell Development in Current Topics
in
Microbiology and Immunology (L. Wolff and A.S. Perkins, Eds.) 211:289-298, 1996 (Review). Berlin and New York: Springer-Verlag; and Liu, P.P., Hajra, A., Wijmenga, C., and Collins, F.S.
``Molecular pathogenesis of the chromosome 16 inversion in
the M4Eo subtype of acute myeloid leukemia.'' Blood 85:2289-2302, 1995 (Review).
Mr. Hajra submitted a fabricated nucleotide sequence in computer data base entry U22149, ``Human leukemia-associated core binding factor subunit CBFbeta (CBFB) gene, promoter region and partial CDs.'' GenBank
(NCBI, NLM, NIH), March 3, 1995 (withdrawn).
He also fabricated the majority of data reported
in his dissertation
(Hajra, A. ``Transformation properties of the leukemic CBF-SMMHC chimeric protein.'' Dissertation, University of Michigan, Ann Arbor, MI, 1995), and he fabricated and falsified original research data
in a submitted but unpublished manuscript
(Hajra, A., Liu, P.P., Itoh, K., Kelley, C.A., Speck, N.A., Adelstein, R.S., and Collins, F.S. ``Myosin heavy
chain properties necessary for cellular transformation by the leukemic CBF-SMMHC oncoprotein,'' submitted for publication to Oncogene on November 29, 1995, and on May 15, 1996).
Mr. Hajra has accepted the ORI finding and has entered into a Voluntary Exclusion Agreement with ORI in which he has voluntarily agreed, for the four (4) year period beginning July 7, 1997, to exclude himself from:
(1) Contracting or subcontracting with any agency of the United States Government and from eligibility for, or involvement in, nonprocurement transactions (e.g., grants and cooperative agreements) of the United States Government as defined in 45 CFR Part 76 (Debarment
Regulations);
(2) Serving in any advisory capacity to the Public Health Service (PHS), including but not limited to service on any PHS advisory committee, board, and/or peer review committee, or as a consultant.
Mr. Hajra agreed to request or cooperate in requesting the retraction or correction of those research publications that have not already been corrected or retracted. He also agreed to notify the
relevant editors of the affected review articles that the articles cannot be relied upon.
FOR FURTHER INFORMATION CONTACT: Acting Director, Division of Research
Investigations, Office of Research Integrity, 5515 Security Lane, Suite
700, Rockville, MD 20852, (301)443-5330.
Chris B. Pascal,
Acting Director, Office of Research Integrity.
[FR Doc. 97-18453 Filed 7-14-97; 8:45 am]
BILLING CODE 4160-17-P
From
Hajra, A., Collins, F.S. ``Structure of the leukemia-associated human CBFB gene.'' Genomics 26(3):571-579,1995 (Retracted in Genomics 38(1):107, 1996);
TCGACAAGAAACGCCCTATGTACCCAATGACTGTCAGTGTGCAGCGTTAAATCTGCCTAC
GCTCTCACTCACTCGCCTCGTTCTTCTGCATAGCTTGTCGCCGGCGAGTGTTGGTCGGGA
GGCAATGCCCATCCGCGTCGCGTTTCGCGCGGCCTCTTTTACAGCCGGCGTCGGCACACAC
GCTTAAGTCCGCCGTCCAGTGCCCCGTCTTCCCTTCCCATTGTTTTCGCGCTCCGCAAATA
TAGATCTTTTCCTAGAAGGCACGGGCCCCCTGGGGCGCTGTACCACGGCCCGCCTGGCTG
GGGAGCCAAGGACTGGCTCTTGGCTGTGTCAAAGGCCAAGATGTAGCCCTCAACCAGTAT
ACTGCCTTGGACCGAGCCTCTAAGAAGAGGGGCGGATGGAAGCGACTGCTTTGGCTCGTT
CCCCCAGAAGACAACGGCGGGCCGAGTGCAAGTGGGCGAGCAGGGGGAAGGTTTCCCTGA
TCCCAGCGGCGCACGCGGGTGGGTTAGCCAGGCCCCGGCGCGGGCGGGCGGGTGGATCAT
GCGGCGTGTTTGCTAGAGTTTGAGATGGGGCGGGCTGGTCGAACTAGATGGAGGCGGAG
GAGCGGTGGGGGCGGCCGGGGCCGGGTGCGCGGGAGGGCGGTGGGCGGTGAGAGGAAGT
GGCGGCGGCGGCGGCGGCGGCGGCCGGGGGCGGGAGCGCTGGGGCTGCGCGGGCGGCAGG
CAACGGCTGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGTGGGTTGGGCTCGAGC
GCGCCCGGCGCCTCAGCCTCCCCGGAACGGGACCCACGCGCGCGCGCGCCTGAAACAAAG
GCAAGCGCGCGTCCGGGGCCCCGCGGGTGGGCGGTCAGTCGGTCAGCGCGGAGCCAGCCA
GCGGGTGCCCGCGCAAGCCCCGAGCGCGGCCGGCGCGGCCTCAGGGCGGGAAGATGCCGC
GCGTCGTGCCCGACCAGAGAAGCAAGTTCGAGAACGAGGAGTTTTTTAGGAAGCTGAGC
CGCGAGTGTGAGGTGAGGCAGGCGGGCGGGCGGCTAGGAGGCCGCAGCGCGCCCCGAGTG
GGCCCGGGCGG
USE BLAST TO ANALYZE
http://www.ncbi.nlm.nih.gov/blast/Blast.cgi
From
Hajra, A., Liu, P.P., Speck, N.A., Collins, F.S.
``Overexpression of core-binding factor (CBF)
reverses cellular transformation by the CBF-smooth muscle myosin heavy chain chimeric oncoprotein.'' Molecular and Cellular
Biology 15(9):4980-4989, 1995;
http://mcb.asm.org/cgi/reprint/15/9/4980.pdf
Patchwork Data?
FIG. 1. Expression of Cbfa2 in stably transfected NIH 3T3 cells.
1 2 3 4 5 6
FIG. 2. (A) Immunoblot showing expression of CBFb-SMMHC in cells previously expressing an empty hygr vector (h 1 CM; lanes 2 to 4) or Cbfa2 (a2 1
CM; lanes 5 to 7). h 1 n (lane 1) is an extract from cells expressing only empty hygr and neor vectors.
1 2 3 4 5 6 7
For Further Reading,
SCIENCE VOL 312 7 APRIL 2006 pg 38-43 –
JENNIFER COUZIN AND
KATHERINE UNGER
http://www.sciencemag.org/cgi/content/summary/312/5770/38
Falsified Data Found in Gene Studies NYTimes,
Oct 30, 1996 By LAWRENCE K. ALTMAN
The Aftermath of Scientific Fraud
Cell Volume 124, Issue 5, 10 March 2006, Pages 873-875 doi:10.1016/j.cell.2006.02.032
Laura Bonetta
Science Fraud: From Patchwork Mice to Patchwork Data
FASEB J., PG 587-590
Gerald Weissmann
http://www.fasebj.org/cgi/reprint/20/6/587.pdf
http://ori.dhhs.gov/documents/newsletters/vol5_no4.pdf

